Note to users. If you're seeing this message, it means that your browser cannot find this page's style/presentation instructions -- or possibly that you are using a browser that does not support current Web standards. Find out more about why this message is appearing, and what you can do to make your experience of our site the best it can be.
Active Motif, Inc.

Site Tools

  • AAAS
  • Subscribe
  • Feedback

Site Search

Search Advanced

Science 26 October 2001:
Vol. 294. no. 5543, pp. 853 - 858
DOI: 10.1126/science.1064921


Abstract
Full Text
Identification of Novel Genes Coding for Small Expressed RNAs
M. Lagos-Quintana, R. Rauhut, W. Lendeckel, T. Tuschl

Supplementary Material


Supplemental Table 1. D. melanogaster miRNA sequences and genomic location. The sequences given represent the most abundant, and typically longest miRNA sequences identified by cloning. It was frequently observed that miRNAs vary in length by one or two nucleotides at their 3´ terminus. From 222 short RNAs sequenced, 69 (31%) corresponded to miRNAs, 103 (46%) to already characterized functional RNAs (rRNA, 7SL RNA, tRNAs), 30 (14%) to transposon RNA fragments, and 20 (10%) sequences with no database entry. RNA sequences with a 5´ guanosine are likely to be underrepresented due to the cloning procedure (8). miRNA homologs found in other species are indicated. Chromosomal location (chr.) and GenBank accession numbers (acc. nb.) are indicated. No ESTs matching miR-1 to miR-14 were detectable by database searching.
miRNASequence (5´ to 3´)chr., acc. nb.remarks
miR-1UGGAAUGUAAAGAAGUAUGGAG2L, AE003667homologs: C. briggsae, G20U, AC87074; C.elegans G20U, U97405; mouse, G20U, G22U, AC020867; human, chr. 20, G20U, G22U, AL449263; ESTs: zebrafish, G20U, G22U, BF157601; cow, G20U, G22U, BE722224; human, G20U, G22U, AI220268
miR-2aUAUCACAGCCAGCUUUGAUGAGC2L, AE0036632 precursor variants clustered with a copy of mir-2b
miR-2bUAUCACAGCCAGCUUUGAGGAGC2L, AE003620 2L, AE0036632 precursor variants
miR-3UCACUGGGCAAAGUGUGUCUCA2R, AE003795in cluster mir-3 to mir-6
miR-4AUAAAGCUAGACAACCAUUGA2R, AE003795in cluster mir-3 to mir-6
miR-5AAAGGAACGAUCGUUGUGAUAUG2R, AE003795in cluster mir-3 to mir-6
miR-6UAUCACAGUGGCUGUUCUUUUU2R, AE003795in cluster mir-3 to mir-6 with 3 variants
miR-7UGGAAGACUAGUGAUUUUGUUGU2R, AE003791homologs: human, chr. 19 AC006537, EST BF373391; mouse chr. 17 AC026385, EST AA881786
miR-8UAAUACUGUCAGGUAAAGAUGUC2R, AE003805
miR-9UCUUUGGUUAUCUAGCUGUAUGA3L, AE003516homologs: mouse, chr. 19, AF155142; human, chr. 5, AC026701, chr. 15, AC005316
miR-10ACCCUGUAGAUCCGAAUUUGU AE001574homologs: mouse, chr 11, AC011194; human, chr. 17, AF287967
miR-11CAUCACAGUCUGAGUUCUUGC 3R, AE003735intronic location
miR-12UGAGUAUUACAUCAGGUACUGGUX, AE003499intronic location
miR-13aUAUCACAGCCAUUUUGACGAGU3R, AE003708 X, AE003446mir-13a clustered with mir-13b on chr. 3R
miR-13bUAUCACAGCCAUUUUGAUGAGU3R, AE003708mir-13a clustered with mir-13b on chr. 3R
miR-14UCAGUCUUUUUCUCUCUCCUA2R, AE003833no signal by Northern analysis


Supplemental Table 2. Human miRNA sequences and genomic location. From 220 short RNAs sequenced, 100 (45%) corresponded to miRNAs, 53 (24%) to already characterized functional RNAs (rRNA, snRNAs, tRNAs), and 67 (30%) sequences with no database entry. For legend, see Table 1.
miRNAsequence (5´ to 3´)chr. or EST, acc. nb.remarks*
let-7aUGAGGUAGUAGGUUGUAUAGUU9, AC007924, 11, AP001359, 17, AC087784, 22, AL049853sequences of chr 9 and 17 identical and clustered with let-7f, homologs: C. elegans, AF274345; C. briggsae, AF210771, D. melanogaster, AE003659
let-7bUGAGGUAGUAGGUUGUGUGGUU22, AL049853dag, ESTs, AI382133, AW028822homologs: mouse, EST AI481799; rat, EST, BE120662
let-7cUGAGGUAGUAGGUUGUAUGGUU21, AP001667Homologs: mouse, EST, AA575575
let-7dAGAGGUAGUAGGUUGCAUAGU17, AC087784, 9, AC007924identical precursor sequences
let-7eUGAGGUAGGAGGUUGUAUAGU19, AC018755
let-7fUGAGGUAGUAGAUUGUAUAGUU9, AC007924, 17, AC087784, X, AL592046sequences of chr 9 and 17 identical and clustered with let-7a
miR-15UAGCAGCACAUAAUGGUUUGUG13, AC069475in cluster with mir-16 homolog
miR-16UAGCAGCACGUAAAUAUUGGCG13, AC069475in cluster with mir-15 homolog
miR-17ACUGCAGUGAAGGCACUUGU13, AL138714in cluster with mir-17 to mir-20
miR-18UAAGGUGCAUCUAGUGCAGAUA13, AL138714in cluster with mir-17 to mir-20
miR-19aUGUGCAAAUCUAUGCAAAACUGA13, AL138714in cluster with mir-17 to mir-20
miR-19bUGUGCAAAUCCAUGCAAAACUGA13, AL138714, X, AC002407in cluster with mir-17 to mir-20
miR-20UAAAGUGCUUAUAGUGCAGGUA13, AL138714in cluster with mir-17 to mir-20
miR-21UAGCUUAUCAGACUGAUGUUGA17, AC004686, EST, BF326048homologs: mouse, EST, AA209594
miR-22AAGCUGCCAGUUGAAGAACUGUESTs, AW961681Dag, AA456477, AI752503, BF030303, HS1242049human ESTs highly similar; homologs: mouse, ESTs, e.g. AA823029; rat, ESTs, e.g. BF543690
miR-23AUCACAUUGCCAGGGAUUUCC19, AC020916homologs: mouse, EST, AW124037;rat, EST, BF402515
miR-24UGGCUCAGUUCAGCAGGAACAG9, AF043896, 19, AC020916homologs: mouse, ESTs, AA111466, AI286629; pig, EST, BE030976
miR-25CAUUGCACUUGUCUCGGUCUGA7, AC073842, EST, BE077684human chr 7 and EST identical; highly similar precursors in mouse ESTs (e.g. AI595464); fish precursor different STS: G46757
miR-26aUUCAAGUAAUCCAGGAUAGGCU3, AP000497
miR-26bUUCAAGUAAUUCAGGAUAGGUU2, AC021016
miR-27UUCACAGUGGCUAAGUUCCGCU19, AC20916U22C mutation in human genomic sequence
miR-28AAGGAGCUCACAGUCUAUUGAG3, AC063932
miR-29CUAGCACCAUCUGAAAUCGGUU7, AF017104
miR-30CUUUCAGUCGGAUGUUUGCAGC6, AL035467
miR-31GGCAAGAUGCUGGCAUAGCUG9, AL353732
miR-32UAUUGCACAUUACUAAGUUGC9, AL354797not detected by Northern blotting
miR-33GUGCAUUGUAGUUGCAUUG22, Z99716not detected by Northern blotting
*If several ESTs were retrieved for one organism in the database, only those with different precursor sequences are listed.
Dagprecursor structure shown in Fig. 4.


Supplemental Figure 1. Expression of D. melanogaster miRNAs. Northern blots of total RNA isolated from staged populations of D. melanogaster were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA serves as loading control. E, embryo; L, larval stage; P, pupae; A, adult; S2, Schneider-2 cells. It should be pointed out, that S2 cells are polyclonal, derived from an unknown subset of embryonic tissues, and may have also lost some features of their tissue of origin while maintained in culture. miR-3 to miR-6 RNAs were not detectable in S2 cells (data not shown). miR-14 was not detected by Northern blotting and may be very weakly expressed, which is consistent with its cloning frequency. Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes.


Medium version | Full size version


Supplemental Figure 2. Expression of vertebrate miRNAs. Northern blots of total RNA isolated from HeLa cells, mouse kidneys, adult zebrafish, frog ovaries, and S2 cells were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA from the preparations of total RNA from the indicated species is also shown. The gels used for probing of miR-18, miR-19a, miR-30, and miR-31 were not run as far as the other gels (see tRNA marker position). miR-32 and miR-33 were not detected by Northern blotting, which is consistent with their low cloning frequency. Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes.


Medium version | Full size version


Northern blotting. Total RNA isolation was performed by acid guanidinium thiocyanate-phenol-chloroform extraction (P. Chomczynski, N. Sacchi, Anal Biochem 162, 156 (1987)). Northern analysis was performed as described (1), except that the total RNA was resolved on a 15% denaturing polyacrylamide gel, transferred onto Hybond-N+ membrane (Amersham Pharmacia biotech), and the hybridization and wash steps were performed at 50 °C. Oligodeoxynucleotides used as Northern probes were let-7a, 5´ TACTATACAACCTACTACCTCAATTTGCC; let-7d, 5´ ACTATGCAACCTACTACCTCT; let-7e, 5´ ACTATACAACCTCCTACCTCA; D. melanogaster val-tRNA, 5´ TGGTGTTTCCGCCCGGGAA; miR-1, 5´ TGGAATGTAAAGAAGTATGGAG; miR-2b, 5´ GCTCCTCAAAGCTGGCTGTGATA; miR-3, 5´ TGAGACACACTTTGCCCAGTGA; miR-4, 5´ TCAATGGTTGTCTAGCTTTAT; miR-5, 5´ CATATCACAACGATCGTTCCTTT; miR-6, 5´ AAAAAGAACAGCCACTGTGATA; miR-7, 5´ TGGAAGACTAGTGATTTTGTTGT; miR-8, 5´ GACATCTTTACCTGACAGTATTA; miR-9, 5´ TCATACAGCTAGATAACCAAAGA; miR-10, 5´ ACAAATTCGGATCTACAGGGT; miR-11, 5´ GCAAGAACTCAGACTGTGATG; miR-12, 5´ ACCAGTACCTGATGTAATACTCA; miR-13a, 5´ ACTCGTCAAAATGGCTGTGATA; miR-14, 5' TAGGAGAGAGAAAAAGACTGA; miR-15, 5´ TAGCAGCACATAATGGTTTGT; miR-16, 5´ GCCAATATTTACGTGCTGCTA; miR-17, 5´ TACAAGTGCCTTCACTGCAGTA; miR-18, 5´ TATCTGCACTAGATGCACCTTA; miR-19a, 5´ TCAGTTTTGCATAGATTTGCACA; miR-20, 5´ TACCTGCACTATAAGCACTTTA; miR-21, 5´ TCAACATCAGTCTGATAAGCTA; miR-22, 5´ ACAGTTCTTCAACTGGCAGCTT; miR-23, 5´ GGAAATCCCTGGCAATGTGAT; miR-24, 5´ CTGTTCCTGCTGAACTGAGCCA; miR-25, 5´ TCAGACCGAGACAAGTGCAATG; miR-26a, 5´ AGCCTATCCTGGATTACTTGAA; miR-27; 5´ AGCGGAACTTAGCCACTGTGAA; miR-28, 5´ CTCAATAGACTGTGAGCTCCTT; miR-29, 5´ AACCGATTTCAGATGGTGCTAG; miR-30, 5´ GCTGCAAACATCCGACTGAAAG; miR-31, 5´ CAGCTATGCCAGCATCTTGCCT; miR-32, 5' GCAACTTAGTAATGTGCAATA; miR-33, 5' TGCAATGCAACTACAATGCACC. 5S rRNA was detected by ethidium staining of polyacrylamide gels prior to transfer. Blots were stripped by boiling in 0.1% aqueous sodium dodecylsulfate/0.1x SSC (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) for 10 min, and were re-probed up to 4 times until the 21-nt signals became too weak for detection. Finally, blots were probed for val-tRNA as size marker.





ADVERTISEMENT
Click Me!

ADVERTISEMENT
Click Me!

To Advertise     Find Products


Science. ISSN 0036-8075 (print), 1095-9203 (online)